MECHANISTIC ENZYMOLOGY OF HIV PROTEINS

人逆转录酶（RT）的作用机制

Mechanisms of action of the reverse transcriptase (RT) of human immunodeficiency virus type 1 (HIV-1) as well as other DNA polymerizing enzymes are being investigated with the goal of developing specific inhibitors for RT. We have previously reported steady-state kinetics for the incorporation of a single nucleotide residue derived from thymidine or 4-thiothymidine triphosphate (TTP or 4S-TTP respectively) into a primer, TCGCAGCCG, annealed to the DNA template, AAACCCTTGGACGGCTGCGA, catalyzed by the Klenow fragment of Escherichia coli DNA polymerase I. These results have now been supplemented by single turnover studies using stopped flow spectrophotometry. Measurements (340 nm) of reaction progress on a millisecond time scale for periods up to 2 s were made at an enzyme concentration of 2 micromolar and concentrations of 4S-TTP between 2.5 and 30 micromolar. The apparent pseudo-first-order rate constant approached a limiting value of 3-4 reciprocal seconds at high 4S-TTP concentration. This rate constant is about tenfold smaller than that reported for the pre-steady--state "burst" phase in the analogous reaction of TTP, which corresponds to the catalytic process within the TTP/enzyme/template-primer complex, and involves a conformational change of the complex followed by very fast covalent bond formation. The steady- state turnover rate constant of 1.8 reciprocal seconds for 4S-TTP is about 3-5 fold larger than that for TTP. These results suggest that substitution of sulfur for oxygen in the thymine base markedly decreases the rate of the one or both of the steps involved in catalysis, while slightly increasing the rate of dissociation of the oligonucleotide product. As a result, the rate of the catalytic process with 4S-TTP approaches that of dissociation of the oligonucleotide product, such that the step(s) in this process may be partially rate limiting for the overall reaction. In contrast, for elongation of this oligonucleotide primer by a single residue of the normal substrate, TTP, the catalytic process is fast and dissociation of the oligonucleotide product is rate limiting under steady-state conditions.